Menu

Oszustwo zostało potwierdzone: PCR nie wykrywa SARS-CoV-2

20 grudnia, 2020 - Koronawirus
Oszustwo zostało potwierdzone: PCR nie wykrywa SARS-CoV-2

Sekwencje genetyczne stosowane w PCR do wykrywania SARS-CoV-2 oraz do diagnozowania przypadków choroby i śmierci przypisywanej COVID-19 są obecne w dziesiątkach sekwencji samego genomu człowieka oraz w sekwencjach około stu drobnoustrojów. Obejmuje to inicjatory lub startery, najbardziej rozległe fragmenty pobrane losowo z ich rzekomego „genomu”, a nawet tak zwane „geny docelowe” rzekomo specyficzne dla „nowego koronawirusa”. Test jest bezwartościowy, a wszystkie wyniki „pozytywne” uzyskane do tej pory, powinny zostać naukowo unieważnione i przekazane osobom poszkodowanym, a jeśli już nie żyją – ich bliskim. Stephen Bustin, jeden z czołowych światowych ekspertów w dziedzinie PCR, mówi, że w pewnych warunkach każdy może uzyskać wynik pozytywny!

Nie można przeprowadzić określonych testów na wirusa bez znajomości składników wirusa, który próbujesz wykryć. A składników nie można poznać bez wcześniejszego wyizolowania / oczyszczenia tego wirusaW niniejszym raporcie przedstawimy nowe dane, które pokazują, że test RT-PCR nie wykrywa tak zwanego SARS-CoV-2, jak jest znany, ale fragmenty ludzkiego RNA i wiele drobnoustrojów.

Żaden z siedmiu „ludzkich koronawirusów” nie został w rzeczywistości wyizolowany, a wszystkie sekwencje starterów ich odpowiednich reakcji PCR, jak również sekwencje dużej liczby fragmentów ich rzekomych genomów, znajdują się w różnych obszarach ludzkiego genomu oraz w genomach bakterii takich jak: Shwanella marina JCM, Dialister succinatiphilus Lactobacillus świnie, manihotivorans Lactobacillus, Leptospira sarikeiensis, Bizionia echini, Sanguibacteroides justesenil, Bacteroides massiliensis, Lacinutrix Venerupis Moraxella bovis, Leptospira saintgironsiae, Winogradskyella undariae, Acetobacterium puteale, Chryseobacterium hispanicum, Paenibacillius koleovorans, fuccidanivorans Tamiana, Fontibacillua panacisegetis Ru Bacter ruber , Skemania piniformis, Chryseobacterium shigense, Caloramator peoteoclasticus, Cellulosilyticum ruminicola, Nitrosopumilius evryensis.

Wyjaśnimy krok po kroku badania, które doprowadziły nas do tak niezwykłego wniosku.

CZY JAKIEŚ LUDZKIE KORONAWIRUSY ZOSTAŁY WYIZOLOWANE?

W pierwszej połowie kwietnia, kiedy pierwsze badania wykazały, że SARS-CoV-2 nie został wyizolowany, Ci, którzy twierdzili, że tego dokonali, polegali na „izolatach” poprzednich „ludzkich koronawirusów”. Przeanalizowane zostały domniemane prace izolacyjne podejrzanych ludzkich koronawirusów 229E (podobno wyizolowanych w 1965 r.), OC43 (w 1967 r.), SARS-CoV (w 2003 r.), NL63 (w 2004 r.), HKU1 (w 2005 r.) I MERSCoV (w 2012). Oto wyniki:

Koronawirus 229E

Artykuł referencyjny: Dorothy Hamre i John ProcknowNowy wirus wyizolowany z dróg oddechowych człowieka. Postępowanie Towarzystwa Medycyny i Biologii Eksperymentalnej, 121: 1: 190-193. 1 stycznia 1966.

Ponieważ autorzy odwołują się do innych artykułów, aby wyjaśnić metodę izolacji – którą nazywają fiksacją dopełniacza – to metoda ta zweryfikowana została z artykułem referencyjnym: Janet W. Hartley i wsp. Test utrwalania dopełniacza i hodowli tkankowej dla wirusów mysiej białaczki PNAS, 53 (5): 931-938, maj 1965. Jest to procedura już nieużywana, która wykorzystuje reakcję antygen-przeciwciał do wykrycia jednego lub drugiego. W przypadku, z którym mamy do czynienia, celem było wykrycie antygenów rzekomego nowego wirusa, ale potrzebne są specyficzne przeciwciała, których nie można uzyskać przy pierwszym wykryciu wirusa.

Koronawirus OC43

Artykuł referencyjny: Paul LeeEpidemiologia molekularna ludzkiego koronawirusa OC43 w Hongkongu. Praca magisterska na Wydziale Mikrobiologii Uniwersytetu w Hongkongu, sierpień 2007. The HKU Scholars Hub.

To, co uznano za wirusowe RNA, wyekstrahowano z kultur bez żadnego dowodu, że RNA należy do wirusa. Użyte narzędzie – zestaw QIAamp – usuwa odczynniki, inhibitory i zanieczyszczenia, ale to, czego nie może zrobić, to określić, skąd pochodzi wyekstrahowany RNAI nie ma żadnych kontroli. Następnie jest amplifikowany przez PCR i sekwencjonowany przy założeniu (!), że jest to informacja genetyczna wirusa. Wreszcie, autor spekuluje na temat mutacji, rekombinacji, genotypów, ewolucji molekularnej, szczepów i innego żargonu, który przekazuje ideę – nieudowodnioną – że pracuje się nad „wirusem”.

Koronawirus SARS-CoV

Artykuł referencyjny: JSM Peiris i inniKoronawirus jako możliwa przyczyna SARS. Lancet  361: 1319-25, kwiecień 2003.

W artykule nie ma wzmianki o oczyszczeniu . Nie ma nawet wzmianki o filtracji lub wirowaniu. Stwierdzono jedynie, że „wirusy zostały wyizolowane w komórkach wątroby płodu małpy z aspiratów z jamy nosowo-gardłowej i biopsji płuc dwóch pacjentów”Nie ma żadnych kontroli. Jedyną wzmianką jest „efekt cytopatyczny” przypisywany wirusowi i że przeprowadzono PCR dla znanych wirusów i retrowirusów bez uzyskania wyników. Wreszcie, RT-PCR przeprowadzono z „przypadkowymi inicjatorami” i wykryto sekwencję „nieznanego pochodzenia”, w której stwierdzono „słabą homologię z rodziną koronawirusów” . Następnie zaprojektowali startery dla tej sekwencji i podczas testowania 44 próbek z SARS tylko 22 pacjentów było pozytywnych.

Koronawirus NL63

Artykuł referencyjny: Lia van der Hock i inniIdentyfikacja nowego ludzkiego koronawirusa. Nature Medicine, 10, 4 kwietnia 2004.

Autorzy stwierdzają, że „identyfikacja nieznanych patogenów za pomocą narzędzi biologii molekularnej jest trudna, ponieważ sekwencja docelowa nie jest znana, więc nie można zaprojektować inicjatorów specyficznych dla PCR”.

Użyli narzędzia, które sami opracowali, zwanego VIDISCA, które, jak twierdzą, nie wymaga wcześniejszej znajomości sekwencji! Czy to jest możliwe? Zobaczmy, jak to działa: najpierw przygotowuje się hodowlę i zakłada się, że wirus jest obecny ze względu na „efekt cytopatyczny”. Nowością wprowadzoną tą metodą jest to, że dodaje się „enzymy restrykcyjne”, enzymy, które tną cząsteczki kwasu nukleinowego w określonych miejscach i zawsze o tej samej długości. W ten sposób, jeśli po działaniu tych enzymów zaobserwują wiele fragmentów DNA lub RNA, które są takie same lub bardzo podobne, wnioskują, że pochodzi on od wirusa, ponieważ genom gospodarza miałby losowe cięcia, podczas gdy genom wirusa przedstawia duża liczba kopii, które są takie same ze względu na rozszerzenie replikacji wirusa. I czy takie odliczenie jest prawidłowe? Oczywiście, że nie! To założenie (które uzupełnia poprzednie założenie, że istnieje wirus) nie bierze pod uwagę faktu, że istnieją „cząsteczki wirusopodobne”, „cząstki podobne do retrowirusów”, „endogenne retrowirusy”, „egzosomy”, „cząsteczki zewnątrzkomórkowe” a nawet mitochondrialne DNA. Zaprzecza się temu, że istnieje wiele cząstek, które w dużych ilościach mają te same cechy reprodukcyjne, co „wirusy” i dlatego mogą fałszować wyniki, wytwarzając dużą liczbę identycznych kopii po cięciu enzymami.

Koronawirus HKU1

Artykuł referencyjny: Patrick CY Woo i inniCharakterystyka i pełna sekwencja genomu nowego koronawirusa HKU1, pochodzącego od pacjentów z zapaleniem płuc. Journal of Virology, 79, 2, styczeń 2005.

Artykuł, co niewiarygodne, zaczyna się słowami: „Pomimo szeroko zakrojonych badań przeprowadzonych na pacjentach z infekcjami dróg oddechowych, u znacznej części pacjentów nie zidentyfikowano żadnej przyczyny mikrobiologicznej. RNA jest ekstrahowane z nieoczyszczonych kultur komórkowych”. Stosuje się również PCR z genami koronawirusa. Do sekwencjonowania wykorzystują dwie bazy danych białek zorganizowanych w rodzinach, w domenach i miejscach funkcjonalnych – PFAM i INterProScan – w połączeniu z dwoma programami komputerowymi, które wykonują „przewidywania” dotyczące łączenia nukleotydów. W tekście dodano: „ Sekwencje zostały ręcznie złożone i poddane edycji w celu uzyskania ostatecznej sekwencji genomu wirusa” znowu nie ma kontroli.

Koronawirus MERS-CoV

Artykuł referencyjny: Ali Moh Zaki i inniIzolacja nowego koronawirusa od mężczyzny z zapaleniem płuc w Arabii Saudyjskiej. The New England Journal of Medicine, 367: 19, listopad 2012.

Materiał genetyczny jest ekstrahowany bezpośrednio z supernatantu hodowli i próbki plwociny za pomocą narzędzia o nazwie High Puré Viral Nucleic Acid Kit, a następnie testowany różnymi metodami PCR pod kątem różnych znanych mikroorganizmów. Nie ma wzmianki o oczyszczaniu i nie ma kontroli.

Krótko mówiąc, toco zostało zrobione w przypadku pierwszych koronawirusów – i wielu innych rzekomych wirusów – to hodowanie rzekomo zainfekowanych tkanek – każdy „efekt cytopatyczny” przypisywano jedynie obecności wirusa – a następnie uzyskuje się pewne białka, które bez żadnego testu są uważane za “antygeny wirusa” i kiedy te “antygeny” są wykrywane w hodowlach, jest to interpretowane jako “izolacja” lub wyekstrahowane fragmenty kwasów nukleinowych przy założeniu, że należą do wirusa.

Artykuł “Antybiotykowe uwolnienie egzosomów z powierzchniowo skojarzonym DNA” wyjaśnia, że ​​niektóre substancje – takie jak antybiotyki – dodawane do eksperymentów in vitro mogą obciążać kultury komórkowe, powodując nowe sekwencje, które nie zostały wcześniej wykryte. Zostało to już zauważone przez dr Barbarę McClintock w 1983 roku.

W gruncie rzeczy, ŻADEN Z SIEDMIU przypuszczalnie LUDZKICH KORONAWIRUSÓW, TAK NAPRAWDĘ NIE ZOSTAŁ OCZYSZCZONY I WYIZOLOWANYJedyne, co się między nimi różniło, to procedury i techniki laboratoryjne, które stawały się coraz bardziej wyrafinowane, co w tym przypadku oznaczało nie większą dokładność, ale większą zdolność do oszukiwania, co doprowadziło do wirtualnej produkcji SARS-CoV-2.

A oczywistą konsekwencją braku dowodów na jego izolację jest to, że takie „koronawirusy” nie mogą być pociągane do odpowiedzialności za żadną chorobę. Co więcej, wszystkie testy – jakiegokolwiek rodzaju – oparte na domniemanych składnikach tych „wirusów” (kwasach nukleinowych lub białkach) są całkowicie dyskwalifikowane jako „testy infekcyjne”, a nawet bardziej jako „diagnostyka” chorób.

WIĘCEJ WNIOSKÓW BEZ ODPOWIEDZI

Poniżej odpowiedzi udzielone przez różne władze – polityczne i zdrowotne – z różnych krajów na temat oczyszczania i izolacji SARS-CoV-2.

James McCumiskey – autor książki The Latest Conspiracy: The Biomedical Paradigm – mówi nam, że National Virus Reference Laboratory of Ireland zażądało informacji na temat oczyszczenia i wyizolowania SARS-CoV-2 od Uniwersytetu w Dublinie, który odpowiedział, że „nie ma zapisów, które mogłyby udzielić odpowiedzi na ich zapytanie”. Dyrektor działu prawnego laboratorium nalegał na uzyskanie odpowiedzi od uczelni, która odpowiedziała następująco: „Stanowisko uczelni jest takie, że materiał debaty akademickiej nie może podlegać ustawie o wolności informacji”. Z wniosku NVR wynika, że nie prowadził on hodowli SARS-CoV-2 ani go nie oczyszczał. Potwierdzają jedynie, że „wykryli RNA SARS-CoV-2 w próbkach diagnostycznych”.

22 czerwca grupa ekspertów wysłała konsultacje na podobnych zasadach do brytyjskiego premiera Borisa Johnsona. List został podpisany przez dr Kevina Corbetta, Piersa Corbyna – profesora Imperial College w Londynie – inżyniera i niezależnego badacza, Davida Crowe’adr Andrew Kaufmana , profesora biologii Rogera z Edynburga Watson oraz biolog i chemik David Rasnick – i do dziś nie otrzymali odpowiedzi!

Inna podobna prośba – w tym przypadku skierowana do National Research Council of Canada – otrzymała następującą odpowiedź: „Nie byliśmy w stanie przeprowadzić pełnego przeszukania zapisów NRC, więc z przykrością informujemy, że nie znaleziono żadnych rekordów, które odpowiadają Państwa zapytaniu.”

Dodamy, że dwóch dziennikarzy wysyłało podobne wnioski – na podstawie ustawy o wolności informacji – do różnych instytucji w Kanadzie, Nowej Zelandii, Australii, Niemczech, Wielkiej Brytanii i Stanach Zjednoczonych, a od 5 września odpowiedzi udzieliło dwanaście instytucji. Wszystkie wskazują na to samo: że nie mają zapisów pracy opisującej izolację  wirusa, który ma powodować Covid-19

POSZUKIWANIE POCHODZENIA FAŁSZYWEGO GENOMU

Jeśli sekwencje, które zostały opublikowane, nie należą – jak twierdzono – do nowych wirusów, to skąd one pochodzą? Aby spróbować odpowiedzieć na to pytanie, zdecydowaliśmy się przeprowadzić wyszukiwanie za pomocą programu komputerowego o nazwie Basic Local Alignment Search Tool (BLAST), narzędzia do wyszukiwania dopasowania sekwencji, które pozwala nam porównać daną sekwencję ze wszystkimi sekwencjami przechowywanymi w National Institutes Zdrowia Stanów Zjednoczonych. Wyjaśniamy krok po kroku, co zrobiliśmy, aby nasi czytelnicy mogli powtórzyć wyszukiwanie sprawdzić wyniki.

Najpierw zebraliśmy wszystkie inicjatory reakcji PCR opisane w tamtym czasie w protokołach na stronie internetowej WHO:

Następnie wprowadziliśmy sekwencję starterów – tę, która wskazuje początek sekwencji, która ma być wykryta (do przodu) i tę, która wskazuje końcową (do tyłu) – do BLAST, aby mógł wyszukiwać je w dwóch bazach danych: zbiór genomów drobnoustrojów i ten odpowiadający genomowi człowieka.

Sekwencje tak zwane SARS-COV-2 ZNAJDUJĄ SIĘ ZARÓWNO U LUDZI, JAK I W LICZNYCH DROBNOUSTROJACH!

Przyjrzyjmy się szczegółowo procedurze na przykładzie inicjatorów protokołu francuskiego. Na stronie BLAST wybraliśmy Mikroby do przeszukania baz danych genomów drobnoustrojów i przeszliśmy na następną stronę. Następnie pojawił się formularz, w którym wpisaliśmy sekwencję inicjatora przekazywania francuskiego protokołu – czyli ATGAGCTTAGTCCTGTG, wybraliśmy opcję Bardzo podobne sekwencje wcisnęliśmy klawisz BLAST. Zaledwie kilka sekund później pojawiły się wyniki – zrobiliśmy zrzut ekranu (zdjęcie 1) – i pokazano nam 100 sekwencji drobnoustrojów – w szczególności bakterii i archeonów – z koincydencją między 77% a 100% z procentem tożsamości 100%.

Następnie wróciliśmy na stronę główną i gdy po raz drugi wybraliśmy Człowieka do przeszukania ludzkiego genomu, powtórzyliśmy tę samą operację i po kilku sekundach pojawił się wynik, który ponownie przechwyciliśmy na ekranie (zdjęcie 2). Okazuje się, że wprowadzona sekwencja pokrywa się z 74 sekwencjami ludzkiego genomu, z koincydencją między 66% a 100% i procentem identyczności wynoszącym 100%.

A to wskazuje, że sekwencja tego początkowego startera PCR, który ma być specyficzny dla SARS-CoV-2, w rzeczywistości odpowiada 74 fragmentom ludzkiego genomu, a także stu fragmentom drobnoustrojów!

Następnie zdecydowaliśmy się powtórzyć operację, ale z końcowym lub odwrotnym starterem – którym jest CTCCCTTTGTGTGTGT – i wyniki były podobne.

Ponieważ były to bardzo krótkie sekwencje – około dwudziestu liter genetycznych lub nukleotydów – postanowiliśmy spróbować ponownie, ale z sekwencją docelową zdefiniowaną przez te dwa startery, tj. sekwencją domniemanego genomu SARS-CoV-2, która znajduje się między początkowym starterem a podkładem końcowym. Oczywiście do tego potrzebowaliśmy sekwencji, która jest oficjalnie określana jako „genom SARS-CoV-2”. Zdecydowaliśmy się przejdź do witryny National Center for Biotechnology Information. Tam zlokalizowaliśmy „sekwencję docelową”, fragment 108 nukleotydów umiejscowiony między pozycjami 12690 i 12 797 „genomu”, czyli ten:

ATGAGCTTAGTCCTGTTGCACTACGACAGATGTTGTGCCGGTACACAAACTGCTTGCACTGAT GACAATGCGTTAGCTTACAACAACAAAGGGAG .

W ten sposób powtórzyliśmy opisane wcześniej kroki i wyniki ponownie były zaskakujące, ponieważ ponownie pojawiło się 100 sekwencji drobnoustrojów z procentem dopasowania równym 100% i cztery sekwencje ludzkiego genomu z procentem identyczności między 83% a 95%. Dopasowania były zatem niższe, ale ważne jest to, że nadal znajdujemy fragmenty rzekomej „sekwencji docelowej” SARS-CoV-2 zarówno w drobnoustrojach, jak i w naszym własnym genomie.

Naprawdę zdziwieni, zrobiliśmy kolejny krok i przetestowaliśmy z genem uważanym w tamtym czasie za najbardziej specyficzny z SARS-CoV-2, genem E, który ma generować białka otoczki i znajduje się między pozycjami 26.245 a 26.472:

ATGTACTCATTCGTTTCGGAAGAGACAGGTACTACGTTAATAGTTAATAGCGTACTTCTCTTGCT TTCGTGGTATTCTTGCTAGTTACACTAGCCATCCTGCTTCGATTGTGCGTACTGCTGCAATATTG TTAACGTGAGTCTTGTAAAACCTTTACGTTTACTCGTGTTAAAATCTGAATTCTTCTAGAGTTCG ATTCTGGTCTAA .

Powtórzyliśmy już opisane kroki, a wynik był jeszcze bardziej zaskakujący, ponieważ pomimo swojej długości pojawiło się kolejne 100 sekwencji drobnoustrojów z procentem identyczności 100% i 10 sekwencji ludzkiego genomu z procentem identyczności między 80% a 100%. Podobne wyniki uzyskano z fragmentem wybranym losowo i z genem N, który, jak mówią, odpowiada białkom nukleokapsydu SARS-CoV-2.

Ostatecznie zdecydowaliśmy się przetestować gen S, o którym mówi się, że generuje strukturalne białka typu „spike”, które są kluczem do wejścia do komórki i który następnie został uznany za najbardziej specyficzny gen SARS-CoV-2. Ponieważ jest to gen, którego sekwencja jest znacznie dłuższa – 3821 nukleotydów między pozycjami 21 563 i 25 384 – przetestowaliśmy dwa fragmenty wybrane losowo w ramach tego genu, a pierwszy – TTGGCAAAATTCAAGACTCACTTTC – zaowocował wynikiem kolejnym 100 sekwencji drobnoustrojów i 93 sekwencjami ludzkiego genomu i druga – CTTGCTGCTACTAAATGCAGAGTGT 100 sekwencji drobnoustrojów i 90 genomu ludzkiego.

Ostatecznie zdecydowaliśmy się przetestować z inicjatorami Protokołu Japońskiego, jedynego, który zawiera sekwencje docelowe genu S i znowu podobnie: 100 sekwencji drobnoustrojów i 93 sekwencje ludzkiego genomu z procentem tożsamości między 94,12% a 100%!

WNIOSKI

Konsekwencje wszystkiego, co właśnie wyjaśniliśmy, są jasne i natychmiastowe: NIE MA WARTOŚCIOWEGO TESTU DO WYKRYCIA SARS-COV-2, ani test przeciwciał ani test antygenowy, ani RT-PCR, się do tego nie nadaje.

WSZYSTKIE LICZBY „POZYTYWNYCH PRZYPADKÓW”, „ZAKAŻONYCH”, „CHORYCH”, „BEZOBJAWOWYCH” LUB „ZMARŁYCH Z POWODU  COVID-19 ” NIE MAJĄ PODSTAWY NAUKOWEJ I WSZYSTKIE „WYNIKI POZYTYWNE” SĄ wynikami Fałszywie POZYTYWNYMI, o  czym należy niezwłocznie poinformować osoby dotknięte chorobą a osoby odpowiedzialne za to wszystko, z czym obecnie się zmagamy, powinny zostać pociągnięte do odpowiedzialności.

Kończąc należy dodać, że nawet sama WHO tak naprawdę nie wierzy w te testy. Wystarczy przeczytać dokument opublikowany 11 września 2020 roku jako przewodnik laboratoryjny dla SARS-CoV-2 zatytułowany Testy diagnostyczne dla SARS-CoV-2 , który na stronie 5 mówi nam: Zawsze, gdy jest to możliwe, podejrzenie aktywnego zakażenia powinno być badane za pomocą testu amplifikacji kwasu nukleinowego (NAAT), takiego jak RT-PCR. Badania NAAT powinny być ukierunkowane na genom SARS-CoV-2, ale ponieważ nie ma na świecie znanego obiegu SARS-CoV-1, rozsądnym celem jest również sekwencja sarbekowirusa (przypuszczalnie obejmująca co najmniej pięć koronawirusów ludzkich i zwierzęcych, w tym SARS-CoV-1 i SARS-Cov-2).” Oznacza to, że WHO zgadza się na użycie sekwencji niespecyficznych do wykrywania SARS-CoV-2.

To nie wszystko, ponieważ w dalszej części podręcznika stwierdza się: „Optymalna diagnoza składa się z testu NAAT z co najmniej dwoma celami SARS-CoV-2 niezależnymi od genomu; jednak na obszarach, gdzie transmisja jest rozpowszechniona, prosty algorytm pojedynczego celu również może być zastosowany.”

W podręczniku WHO stwierdza się: „Jeden lub więcej negatywnych wyników nie musi wykluczać zakażenia SARS-CoV-2. Istnieje szereg czynników, które mogą spowodować negatywny wynik u zakażonej osoby, w tym niska jakość próbki, późne pobranie próbki, nieodpowiednie obchodzenie się z nią lub przyczyny techniczne związane z testem, takie jak mutacja wirusa lub zahamowanie PCR.”

Sędziowie, teraz ruch po Waszej stronie!

Jesus Garcia Blanca

Uwaga: autor publicznie dziękuje Juanowi Pedro Aparicio Alcarazowi za jego cierpliwą i skrupulatną pracę w poszukiwaniu artykułów naukowych oraz za żmudną pracę z BLAST.

RAPORT DOSTĘPNY JEST TUTAJ

Polecam również artykuł: “Dlaczego test na COVID-19 jest bezużyteczny.”

Źródło: https://www.greenmedinfo.com/blog/scam-has-been-confirmed-pcr-does-not-detect-sars-cov-2

Zarejestruj się tutaj, dowiedz się więcej i skorzystaj z wielu zalet. 
Rejestr
acja do niczego nie zobowiązuje!

Spread the love
Subscribe
Powiadom o
guest
1 Komentarz
Oldest
Newest
Inline Feedbacks
View all comments
Kub10
Kub10
27 dni temu

Kto dokładnie przeprowadził te badania?
Pod podanym linkiem nie idzie znalezc tego raportu…

1
0
Would love your thoughts, please comment.x
()
x